primer 5 Search Results


90
GenScript corporation gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′)
Gapdh (Forward Primer: 5′–Aatcccatcaccatcttcca–3′; Reverse Primer: 5′–Tggactccacgacgtactca–3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ribobio co ngf forward primer 5’-3’: tgc ccc tgc tga acc aa
Ngf Forward Primer 5’ 3’: Tgc Ccc Tgc Tga Acc Aa, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ngf forward primer 5’-3’: tgc ccc tgc tga acc aa/product/Ribobio co
Average 90 stars, based on 1 article reviews
ngf forward primer 5’-3’: tgc ccc tgc tga acc aa - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ella Biotech GmbH forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27)
Forward Primer 5′ Gctgtgtgactcctgcaa 3′ (Seq Id No: 27), supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27)/product/Ella Biotech GmbH
Average 90 stars, based on 1 article reviews
forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Sigma-Genosys forward primer 5′-tac cgg gcg gtg acg gag tg-3′
Forward Primer 5′ Tac Cgg Gcg Gtg Acg Gag Tg 3′, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 5′-tac cgg gcg gtg acg gag tg-3′/product/Sigma-Genosys
Average 90 stars, based on 1 article reviews
forward primer 5′-tac cgg gcg gtg acg gag tg-3′ - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Operon Technologies Inc primer 5'-cca caggaattcctgcagta ctagc -3
Primer 5' Cca Caggaattcctgcagta Ctagc 3, supplied by Operon Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer 5'-cca caggaattcctgcagta ctagc -3/product/Operon Technologies Inc
Average 90 stars, based on 1 article reviews
primer 5'-cca caggaattcctgcagta ctagc -3 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
5 PRIME generacertm nested 3 prime primer
Generacertm Nested 3 Prime Primer, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/generacertm nested 3 prime primer/product/5 PRIME
Average 90 stars, based on 1 article reviews
generacertm nested 3 prime primer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GeNOsys Inc primer 5’ tcagtagacggtgaccgaggttccttgaccccagta3
Primer 5’ Tcagtagacggtgaccgaggttccttgaccccagta3, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer 5’ tcagtagacggtgaccgaggttccttgaccccagta3/product/GeNOsys Inc
Average 90 stars, based on 1 article reviews
primer 5’ tcagtagacggtgaccgaggttccttgaccccagta3 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
5 PRIME 515f primer
515f Primer, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/515f primer/product/5 PRIME
Average 90 stars, based on 1 article reviews
515f primer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega 5′-tcc gct act ggc atc ggt-3′ seq id no:9
5′ Tcc Gct Act Ggc Atc Ggt 3′ Seq Id No:9, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5′-tcc gct act ggc atc ggt-3′ seq id no:9/product/Promega
Average 90 stars, based on 1 article reviews
5′-tcc gct act ggc atc ggt-3′ seq id no:9 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
TIB MOLBIOL forward-primer 5’-ccctgaatgcggctaatcc-3
Forward Primer 5’ Ccctgaatgcggctaatcc 3, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward-primer 5’-ccctgaatgcggctaatcc-3/product/TIB MOLBIOL
Average 90 stars, based on 1 article reviews
forward-primer 5’-ccctgaatgcggctaatcc-3 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
TIB MOLBIOL drd2/ankk1 taq ia (rs1800497) reverse primer
Drd2/Ankk1 Taq Ia (Rs1800497) Reverse Primer, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/drd2/ankk1 taq ia (rs1800497) reverse primer/product/TIB MOLBIOL
Average 90 stars, based on 1 article reviews
drd2/ankk1 taq ia (rs1800497) reverse primer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Microsynth ag backward primer: 5’-tgc ggc tgg act tct cac t-3
Backward Primer: 5’ Tgc Ggc Tgg Act Tct Cac T 3, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/backward primer: 5’-tgc ggc tgg act tct cac t-3/product/Microsynth ag
Average 90 stars, based on 1 article reviews
backward primer: 5’-tgc ggc tgg act tct cac t-3 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results